ID: 1194072969

View in Genome Browser
Species Human (GRCh38)
Location X:89350552-89350574
Sequence AAGGCTCCTCTCCCATTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194072961_1194072969 25 Left 1194072961 X:89350504-89350526 CCAGGTCAGGAACCTGCATATCT No data
Right 1194072969 X:89350552-89350574 AAGGCTCCTCTCCCATTTGAGGG No data
1194072960_1194072969 30 Left 1194072960 X:89350499-89350521 CCACTCCAGGTCAGGAACCTGCA No data
Right 1194072969 X:89350552-89350574 AAGGCTCCTCTCCCATTTGAGGG No data
1194072965_1194072969 -1 Left 1194072965 X:89350530-89350552 CCCTCTCAGTGCTCTGAGGGCGA No data
Right 1194072969 X:89350552-89350574 AAGGCTCCTCTCCCATTTGAGGG No data
1194072962_1194072969 13 Left 1194072962 X:89350516-89350538 CCTGCATATCTCATCCCTCTCAG No data
Right 1194072969 X:89350552-89350574 AAGGCTCCTCTCCCATTTGAGGG No data
1194072966_1194072969 -2 Left 1194072966 X:89350531-89350553 CCTCTCAGTGCTCTGAGGGCGAA No data
Right 1194072969 X:89350552-89350574 AAGGCTCCTCTCCCATTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194072969 Original CRISPR AAGGCTCCTCTCCCATTTGA GGG Intergenic
No off target data available for this crispr