ID: 1194076524

View in Genome Browser
Species Human (GRCh38)
Location X:89400672-89400694
Sequence GTGTGAGATAAAACCAGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194076514_1194076524 3 Left 1194076514 X:89400646-89400668 CCACTGGCTGCCCTCCCCAAGGG 0: 3
1: 12
2: 92
3: 199
4: 519
Right 1194076524 X:89400672-89400694 GTGTGAGATAAAACCAGGAATGG No data
1194076512_1194076524 9 Left 1194076512 X:89400640-89400662 CCAATTCCACTGGCTGCCCTCCC No data
Right 1194076524 X:89400672-89400694 GTGTGAGATAAAACCAGGAATGG No data
1194076511_1194076524 10 Left 1194076511 X:89400639-89400661 CCCAATTCCACTGGCTGCCCTCC No data
Right 1194076524 X:89400672-89400694 GTGTGAGATAAAACCAGGAATGG No data
1194076510_1194076524 11 Left 1194076510 X:89400638-89400660 CCCCAATTCCACTGGCTGCCCTC No data
Right 1194076524 X:89400672-89400694 GTGTGAGATAAAACCAGGAATGG No data
1194076517_1194076524 -8 Left 1194076517 X:89400657-89400679 CCTCCCCAAGGGCCCGTGTGAGA No data
Right 1194076524 X:89400672-89400694 GTGTGAGATAAAACCAGGAATGG No data
1194076509_1194076524 16 Left 1194076509 X:89400633-89400655 CCTTTCCCCAATTCCACTGGCTG No data
Right 1194076524 X:89400672-89400694 GTGTGAGATAAAACCAGGAATGG No data
1194076516_1194076524 -7 Left 1194076516 X:89400656-89400678 CCCTCCCCAAGGGCCCGTGTGAG No data
Right 1194076524 X:89400672-89400694 GTGTGAGATAAAACCAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194076524 Original CRISPR GTGTGAGATAAAACCAGGAA TGG Intergenic
No off target data available for this crispr