ID: 1194083927

View in Genome Browser
Species Human (GRCh38)
Location X:89502633-89502655
Sequence CTGTGTCCCCAAAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194083927_1194083931 23 Left 1194083927 X:89502633-89502655 CCTTCTTCCCTTTGGGGACACAG No data
Right 1194083931 X:89502679-89502701 AAATAACAGCTCCTTAATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194083927 Original CRISPR CTGTGTCCCCAAAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr