ID: 1194087907

View in Genome Browser
Species Human (GRCh38)
Location X:89551942-89551964
Sequence AATTAAGCACAGAATGATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194087907_1194087912 18 Left 1194087907 X:89551942-89551964 CCCAAATCATTCTGTGCTTAATT No data
Right 1194087912 X:89551983-89552005 TAATTGGTATAGATAATCTCAGG No data
1194087907_1194087911 2 Left 1194087907 X:89551942-89551964 CCCAAATCATTCTGTGCTTAATT No data
Right 1194087911 X:89551967-89551989 CTAGTTTCATAATCTATAATTGG No data
1194087907_1194087913 24 Left 1194087907 X:89551942-89551964 CCCAAATCATTCTGTGCTTAATT No data
Right 1194087913 X:89551989-89552011 GTATAGATAATCTCAGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194087907 Original CRISPR AATTAAGCACAGAATGATTT GGG (reversed) Intergenic
No off target data available for this crispr