ID: 1194090813

View in Genome Browser
Species Human (GRCh38)
Location X:89580751-89580773
Sequence GCTTCCGGACTGACCAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194090809_1194090813 8 Left 1194090809 X:89580720-89580742 CCTCAAGCTTCAGCCATGTGTAG No data
Right 1194090813 X:89580751-89580773 GCTTCCGGACTGACCAGAGCAGG No data
1194090811_1194090813 -5 Left 1194090811 X:89580733-89580755 CCATGTGTAGACTGGTCAGCTTC 0: 5
1: 11
2: 26
3: 58
4: 191
Right 1194090813 X:89580751-89580773 GCTTCCGGACTGACCAGAGCAGG No data
1194090808_1194090813 11 Left 1194090808 X:89580717-89580739 CCTCCTCAAGCTTCAGCCATGTG No data
Right 1194090813 X:89580751-89580773 GCTTCCGGACTGACCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194090813 Original CRISPR GCTTCCGGACTGACCAGAGC AGG Intergenic
No off target data available for this crispr