ID: 1194090906

View in Genome Browser
Species Human (GRCh38)
Location X:89581217-89581239
Sequence TGGTGGGGGTGCATCTGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194090895_1194090906 18 Left 1194090895 X:89581176-89581198 CCAGCCAAACAAGATCTCATAGG No data
Right 1194090906 X:89581217-89581239 TGGTGGGGGTGCATCTGACCTGG No data
1194090898_1194090906 14 Left 1194090898 X:89581180-89581202 CCAAACAAGATCTCATAGGGTGA No data
Right 1194090906 X:89581217-89581239 TGGTGGGGGTGCATCTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194090906 Original CRISPR TGGTGGGGGTGCATCTGACC TGG Intergenic
No off target data available for this crispr