ID: 1194091401

View in Genome Browser
Species Human (GRCh38)
Location X:89584312-89584334
Sequence CAGCCTAAGGAGATGGAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194091397_1194091401 -9 Left 1194091397 X:89584298-89584320 CCATGGGCTCCTGGCAGCCTAAG No data
Right 1194091401 X:89584312-89584334 CAGCCTAAGGAGATGGAGCCCGG No data
1194091390_1194091401 9 Left 1194091390 X:89584280-89584302 CCCCTACTTTCACCATGACCATG No data
Right 1194091401 X:89584312-89584334 CAGCCTAAGGAGATGGAGCCCGG No data
1194091389_1194091401 10 Left 1194091389 X:89584279-89584301 CCCCCTACTTTCACCATGACCAT No data
Right 1194091401 X:89584312-89584334 CAGCCTAAGGAGATGGAGCCCGG No data
1194091391_1194091401 8 Left 1194091391 X:89584281-89584303 CCCTACTTTCACCATGACCATGG No data
Right 1194091401 X:89584312-89584334 CAGCCTAAGGAGATGGAGCCCGG No data
1194091393_1194091401 7 Left 1194091393 X:89584282-89584304 CCTACTTTCACCATGACCATGGG No data
Right 1194091401 X:89584312-89584334 CAGCCTAAGGAGATGGAGCCCGG No data
1194091396_1194091401 -3 Left 1194091396 X:89584292-89584314 CCATGACCATGGGCTCCTGGCAG No data
Right 1194091401 X:89584312-89584334 CAGCCTAAGGAGATGGAGCCCGG No data
1194091388_1194091401 21 Left 1194091388 X:89584268-89584290 CCATCAGTTGGCCCCCTACTTTC No data
Right 1194091401 X:89584312-89584334 CAGCCTAAGGAGATGGAGCCCGG No data
1194091387_1194091401 30 Left 1194091387 X:89584259-89584281 CCATAAAGTCCATCAGTTGGCCC No data
Right 1194091401 X:89584312-89584334 CAGCCTAAGGAGATGGAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194091401 Original CRISPR CAGCCTAAGGAGATGGAGCC CGG Intergenic
No off target data available for this crispr