ID: 1194108582

View in Genome Browser
Species Human (GRCh38)
Location X:89802641-89802663
Sequence GTAACACTAAGACACCCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194108576_1194108582 26 Left 1194108576 X:89802592-89802614 CCTGGATTAGGTTGTTCAAACAT No data
Right 1194108582 X:89802641-89802663 GTAACACTAAGACACCCTAAGGG No data
1194108575_1194108582 30 Left 1194108575 X:89802588-89802610 CCTGCCTGGATTAGGTTGTTCAA No data
Right 1194108582 X:89802641-89802663 GTAACACTAAGACACCCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194108582 Original CRISPR GTAACACTAAGACACCCTAA GGG Intergenic
No off target data available for this crispr