ID: 1194112594

View in Genome Browser
Species Human (GRCh38)
Location X:89853807-89853829
Sequence ATGAGAGGCAAGAGCGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194112587_1194112594 7 Left 1194112587 X:89853777-89853799 CCAAGTAAACTTGAAAGGCTGCT No data
Right 1194112594 X:89853807-89853829 ATGAGAGGCAAGAGCGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194112594 Original CRISPR ATGAGAGGCAAGAGCGGGGA GGG Intergenic
No off target data available for this crispr