ID: 1194120113

View in Genome Browser
Species Human (GRCh38)
Location X:89951451-89951473
Sequence TTAACTTTTAATGTGTAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194120113_1194120118 30 Left 1194120113 X:89951451-89951473 CCATTCTACACATTAAAAGTTAA No data
Right 1194120118 X:89951504-89951526 GGTGTGAAAGGAAAATATCTTGG No data
1194120113_1194120115 9 Left 1194120113 X:89951451-89951473 CCATTCTACACATTAAAAGTTAA No data
Right 1194120115 X:89951483-89951505 AACATGCCACTTGTTGTTCAGGG No data
1194120113_1194120114 8 Left 1194120113 X:89951451-89951473 CCATTCTACACATTAAAAGTTAA No data
Right 1194120114 X:89951482-89951504 AAACATGCCACTTGTTGTTCAGG No data
1194120113_1194120117 18 Left 1194120113 X:89951451-89951473 CCATTCTACACATTAAAAGTTAA No data
Right 1194120117 X:89951492-89951514 CTTGTTGTTCAGGGTGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194120113 Original CRISPR TTAACTTTTAATGTGTAGAA TGG (reversed) Intergenic