ID: 1194120114 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:89951482-89951504 |
| Sequence | AAACATGCCACTTGTTGTTC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1194120112_1194120114 | 12 | Left | 1194120112 | X:89951447-89951469 | CCAACCATTCTACACATTAAAAG | No data | ||
| Right | 1194120114 | X:89951482-89951504 | AAACATGCCACTTGTTGTTCAGG | No data | ||||
| 1194120113_1194120114 | 8 | Left | 1194120113 | X:89951451-89951473 | CCATTCTACACATTAAAAGTTAA | No data | ||
| Right | 1194120114 | X:89951482-89951504 | AAACATGCCACTTGTTGTTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1194120114 | Original CRISPR | AAACATGCCACTTGTTGTTC AGG | Intergenic | ||