ID: 1194120115

View in Genome Browser
Species Human (GRCh38)
Location X:89951483-89951505
Sequence AACATGCCACTTGTTGTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194120113_1194120115 9 Left 1194120113 X:89951451-89951473 CCATTCTACACATTAAAAGTTAA No data
Right 1194120115 X:89951483-89951505 AACATGCCACTTGTTGTTCAGGG No data
1194120112_1194120115 13 Left 1194120112 X:89951447-89951469 CCAACCATTCTACACATTAAAAG No data
Right 1194120115 X:89951483-89951505 AACATGCCACTTGTTGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194120115 Original CRISPR AACATGCCACTTGTTGTTCA GGG Intergenic
No off target data available for this crispr