ID: 1194120116

View in Genome Browser
Species Human (GRCh38)
Location X:89951489-89951511
Sequence TTCACACCCTGAACAACAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194120116_1194120119 -7 Left 1194120116 X:89951489-89951511 CCACTTGTTGTTCAGGGTGTGAA No data
Right 1194120119 X:89951505-89951527 GTGTGAAAGGAAAATATCTTGGG No data
1194120116_1194120124 18 Left 1194120116 X:89951489-89951511 CCACTTGTTGTTCAGGGTGTGAA No data
Right 1194120124 X:89951530-89951552 CCAAAACTCGCTAAGCTAAAGGG No data
1194120116_1194120122 17 Left 1194120116 X:89951489-89951511 CCACTTGTTGTTCAGGGTGTGAA No data
Right 1194120122 X:89951529-89951551 CCCAAAACTCGCTAAGCTAAAGG No data
1194120116_1194120118 -8 Left 1194120116 X:89951489-89951511 CCACTTGTTGTTCAGGGTGTGAA No data
Right 1194120118 X:89951504-89951526 GGTGTGAAAGGAAAATATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194120116 Original CRISPR TTCACACCCTGAACAACAAG TGG (reversed) Intergenic