ID: 1194120117

View in Genome Browser
Species Human (GRCh38)
Location X:89951492-89951514
Sequence CTTGTTGTTCAGGGTGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194120113_1194120117 18 Left 1194120113 X:89951451-89951473 CCATTCTACACATTAAAAGTTAA No data
Right 1194120117 X:89951492-89951514 CTTGTTGTTCAGGGTGTGAAAGG No data
1194120112_1194120117 22 Left 1194120112 X:89951447-89951469 CCAACCATTCTACACATTAAAAG No data
Right 1194120117 X:89951492-89951514 CTTGTTGTTCAGGGTGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194120117 Original CRISPR CTTGTTGTTCAGGGTGTGAA AGG Intergenic