ID: 1194123193

View in Genome Browser
Species Human (GRCh38)
Location X:89985704-89985726
Sequence CTGCTGGCATATTGGGCGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194123193_1194123199 17 Left 1194123193 X:89985704-89985726 CCAAGCGCCCAATATGCCAGCAG No data
Right 1194123199 X:89985744-89985766 CTAATAGGGCACCATTTACCAGG No data
1194123193_1194123198 3 Left 1194123193 X:89985704-89985726 CCAAGCGCCCAATATGCCAGCAG No data
Right 1194123198 X:89985730-89985752 AGAACACTGAGAATCTAATAGGG No data
1194123193_1194123197 2 Left 1194123193 X:89985704-89985726 CCAAGCGCCCAATATGCCAGCAG No data
Right 1194123197 X:89985729-89985751 TAGAACACTGAGAATCTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194123193 Original CRISPR CTGCTGGCATATTGGGCGCT TGG (reversed) Intergenic
No off target data available for this crispr