ID: 1194127572

View in Genome Browser
Species Human (GRCh38)
Location X:90039261-90039283
Sequence GGTTGTACTGGAGAACAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194127567_1194127572 -9 Left 1194127567 X:90039247-90039269 CCAGTTGTTTTGAAGGTTGTACT No data
Right 1194127572 X:90039261-90039283 GGTTGTACTGGAGAACAAGGGGG No data
1194127565_1194127572 5 Left 1194127565 X:90039233-90039255 CCTTGCTAAATATTCCAGTTGTT No data
Right 1194127572 X:90039261-90039283 GGTTGTACTGGAGAACAAGGGGG No data
1194127563_1194127572 21 Left 1194127563 X:90039217-90039239 CCTGAAAGCCTTGAATCCTTGCT No data
Right 1194127572 X:90039261-90039283 GGTTGTACTGGAGAACAAGGGGG No data
1194127564_1194127572 13 Left 1194127564 X:90039225-90039247 CCTTGAATCCTTGCTAAATATTC No data
Right 1194127572 X:90039261-90039283 GGTTGTACTGGAGAACAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194127572 Original CRISPR GGTTGTACTGGAGAACAAGG GGG Intergenic
No off target data available for this crispr