ID: 1194130859

View in Genome Browser
Species Human (GRCh38)
Location X:90080057-90080079
Sequence CACACTTTCAGCCCTTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194130855_1194130859 7 Left 1194130855 X:90080027-90080049 CCAACAAATGCATGTAAGAGCTG No data
Right 1194130859 X:90080057-90080079 CACACTTTCAGCCCTTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194130859 Original CRISPR CACACTTTCAGCCCTTCTGG AGG Intergenic
No off target data available for this crispr