ID: 1194140826

View in Genome Browser
Species Human (GRCh38)
Location X:90206998-90207020
Sequence GTTTCAAGATAGAGGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194140826_1194140835 15 Left 1194140826 X:90206998-90207020 CCCTGTTCCCTCTATCTTGAAAC No data
Right 1194140835 X:90207036-90207058 ACAAGCCCAGGCTAGCCTGCTGG No data
1194140826_1194140830 -8 Left 1194140826 X:90206998-90207020 CCCTGTTCCCTCTATCTTGAAAC No data
Right 1194140830 X:90207013-90207035 CTTGAAACTCTGCCACCCTGAGG No data
1194140826_1194140837 19 Left 1194140826 X:90206998-90207020 CCCTGTTCCCTCTATCTTGAAAC No data
Right 1194140837 X:90207040-90207062 GCCCAGGCTAGCCTGCTGGAGGG No data
1194140826_1194140836 18 Left 1194140826 X:90206998-90207020 CCCTGTTCCCTCTATCTTGAAAC No data
Right 1194140836 X:90207039-90207061 AGCCCAGGCTAGCCTGCTGGAGG No data
1194140826_1194140831 3 Left 1194140826 X:90206998-90207020 CCCTGTTCCCTCTATCTTGAAAC No data
Right 1194140831 X:90207024-90207046 GCCACCCTGAGGACAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194140826 Original CRISPR GTTTCAAGATAGAGGGAACA GGG (reversed) Intergenic
No off target data available for this crispr