ID: 1194142583

View in Genome Browser
Species Human (GRCh38)
Location X:90223114-90223136
Sequence GAGAATAAGGCGAATGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194142578_1194142583 -10 Left 1194142578 X:90223101-90223123 CCAGAGAAGAAGAGAGAATAAGG No data
Right 1194142583 X:90223114-90223136 GAGAATAAGGCGAATGGGGCTGG No data
1194142576_1194142583 -3 Left 1194142576 X:90223094-90223116 CCCAGGGCCAGAGAAGAAGAGAG No data
Right 1194142583 X:90223114-90223136 GAGAATAAGGCGAATGGGGCTGG No data
1194142577_1194142583 -4 Left 1194142577 X:90223095-90223117 CCAGGGCCAGAGAAGAAGAGAGA No data
Right 1194142583 X:90223114-90223136 GAGAATAAGGCGAATGGGGCTGG No data
1194142573_1194142583 15 Left 1194142573 X:90223076-90223098 CCAGGGTCTGGAGGTTAGCCCAG No data
Right 1194142583 X:90223114-90223136 GAGAATAAGGCGAATGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194142583 Original CRISPR GAGAATAAGGCGAATGGGGC TGG Intergenic
No off target data available for this crispr