ID: 1194144691

View in Genome Browser
Species Human (GRCh38)
Location X:90247413-90247435
Sequence GAGTAATCACAACTGCTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194144686_1194144691 24 Left 1194144686 X:90247366-90247388 CCCTTGTGCTAAAACTGCACAGA No data
Right 1194144691 X:90247413-90247435 GAGTAATCACAACTGCTTGCAGG No data
1194144689_1194144691 -9 Left 1194144689 X:90247399-90247421 CCTTTTTACAACCTGAGTAATCA No data
Right 1194144691 X:90247413-90247435 GAGTAATCACAACTGCTTGCAGG No data
1194144685_1194144691 29 Left 1194144685 X:90247361-90247383 CCACACCCTTGTGCTAAAACTGC No data
Right 1194144691 X:90247413-90247435 GAGTAATCACAACTGCTTGCAGG No data
1194144687_1194144691 23 Left 1194144687 X:90247367-90247389 CCTTGTGCTAAAACTGCACAGAG No data
Right 1194144691 X:90247413-90247435 GAGTAATCACAACTGCTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194144691 Original CRISPR GAGTAATCACAACTGCTTGC AGG Intergenic
No off target data available for this crispr