ID: 1194151048

View in Genome Browser
Species Human (GRCh38)
Location X:90325528-90325550
Sequence GTAGTTCCAATGTAAGCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194151048_1194151053 20 Left 1194151048 X:90325528-90325550 CCAGATGCTTACATTGGAACTAC No data
Right 1194151053 X:90325571-90325593 CTGAAGAATAGAGAATAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194151048 Original CRISPR GTAGTTCCAATGTAAGCATC TGG (reversed) Intergenic
No off target data available for this crispr