ID: 1194152783

View in Genome Browser
Species Human (GRCh38)
Location X:90345670-90345692
Sequence ATTTGCATGTAATCGTAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194152783_1194152791 9 Left 1194152783 X:90345670-90345692 CCCACTTACGATTACATGCAAAT No data
Right 1194152791 X:90345702-90345724 GTCAATGCAAATTGAGGACCGGG No data
1194152783_1194152793 28 Left 1194152783 X:90345670-90345692 CCCACTTACGATTACATGCAAAT No data
Right 1194152793 X:90345721-90345743 CGGGTCATTTAGAATTTTCCAGG No data
1194152783_1194152790 8 Left 1194152783 X:90345670-90345692 CCCACTTACGATTACATGCAAAT No data
Right 1194152790 X:90345701-90345723 GGTCAATGCAAATTGAGGACCGG No data
1194152783_1194152789 3 Left 1194152783 X:90345670-90345692 CCCACTTACGATTACATGCAAAT No data
Right 1194152789 X:90345696-90345718 GGGGTGGTCAATGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194152783 Original CRISPR ATTTGCATGTAATCGTAAGT GGG (reversed) Intergenic
No off target data available for this crispr