ID: 1194152784

View in Genome Browser
Species Human (GRCh38)
Location X:90345671-90345693
Sequence AATTTGCATGTAATCGTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194152784_1194152789 2 Left 1194152784 X:90345671-90345693 CCACTTACGATTACATGCAAATT No data
Right 1194152789 X:90345696-90345718 GGGGTGGTCAATGCAAATTGAGG No data
1194152784_1194152793 27 Left 1194152784 X:90345671-90345693 CCACTTACGATTACATGCAAATT No data
Right 1194152793 X:90345721-90345743 CGGGTCATTTAGAATTTTCCAGG No data
1194152784_1194152790 7 Left 1194152784 X:90345671-90345693 CCACTTACGATTACATGCAAATT No data
Right 1194152790 X:90345701-90345723 GGTCAATGCAAATTGAGGACCGG No data
1194152784_1194152791 8 Left 1194152784 X:90345671-90345693 CCACTTACGATTACATGCAAATT No data
Right 1194152791 X:90345702-90345724 GTCAATGCAAATTGAGGACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194152784 Original CRISPR AATTTGCATGTAATCGTAAG TGG (reversed) Intergenic
No off target data available for this crispr