ID: 1194152789

View in Genome Browser
Species Human (GRCh38)
Location X:90345696-90345718
Sequence GGGGTGGTCAATGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194152783_1194152789 3 Left 1194152783 X:90345670-90345692 CCCACTTACGATTACATGCAAAT No data
Right 1194152789 X:90345696-90345718 GGGGTGGTCAATGCAAATTGAGG No data
1194152784_1194152789 2 Left 1194152784 X:90345671-90345693 CCACTTACGATTACATGCAAATT No data
Right 1194152789 X:90345696-90345718 GGGGTGGTCAATGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194152789 Original CRISPR GGGGTGGTCAATGCAAATTG AGG Intergenic
No off target data available for this crispr