ID: 1194152789 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:90345696-90345718 |
| Sequence | GGGGTGGTCAATGCAAATTG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1194152783_1194152789 | 3 | Left | 1194152783 | X:90345670-90345692 | CCCACTTACGATTACATGCAAAT | No data | ||
| Right | 1194152789 | X:90345696-90345718 | GGGGTGGTCAATGCAAATTGAGG | No data | ||||
| 1194152784_1194152789 | 2 | Left | 1194152784 | X:90345671-90345693 | CCACTTACGATTACATGCAAATT | No data | ||
| Right | 1194152789 | X:90345696-90345718 | GGGGTGGTCAATGCAAATTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1194152789 | Original CRISPR | GGGGTGGTCAATGCAAATTG AGG | Intergenic | ||