ID: 1194154355

View in Genome Browser
Species Human (GRCh38)
Location X:90368531-90368553
Sequence GCTGACTTAGTCTCAAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194154355_1194154357 21 Left 1194154355 X:90368531-90368553 CCAGTCTTTGAGACTAAGTCAGC No data
Right 1194154357 X:90368575-90368597 ACCTCAATCTATACTATACTTGG No data
1194154355_1194154359 22 Left 1194154355 X:90368531-90368553 CCAGTCTTTGAGACTAAGTCAGC No data
Right 1194154359 X:90368576-90368598 CCTCAATCTATACTATACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194154355 Original CRISPR GCTGACTTAGTCTCAAAGAC TGG (reversed) Intergenic
No off target data available for this crispr