ID: 1194155084

View in Genome Browser
Species Human (GRCh38)
Location X:90378340-90378362
Sequence GGCCTAAATAGAACAAAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194155084_1194155093 10 Left 1194155084 X:90378340-90378362 CCCCCTTTTGTTCTATTTAGGCC No data
Right 1194155093 X:90378373-90378395 TGGGAGATGCCCACTCACAATGG No data
1194155084_1194155089 -10 Left 1194155084 X:90378340-90378362 CCCCCTTTTGTTCTATTTAGGCC No data
Right 1194155089 X:90378353-90378375 TATTTAGGCCCTCAGGAGATTGG No data
1194155084_1194155090 -9 Left 1194155084 X:90378340-90378362 CCCCCTTTTGTTCTATTTAGGCC No data
Right 1194155090 X:90378354-90378376 ATTTAGGCCCTCAGGAGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194155084 Original CRISPR GGCCTAAATAGAACAAAAGG GGG (reversed) Intergenic
No off target data available for this crispr