ID: 1194155338

View in Genome Browser
Species Human (GRCh38)
Location X:90380963-90380985
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194155337_1194155338 4 Left 1194155337 X:90380936-90380958 CCAAGAACTGTTTCTCAAAAGGA No data
Right 1194155338 X:90380963-90380985 AGTCATCTTCAGAGAATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194155338 Original CRISPR AGTCATCTTCAGAGAATGAC AGG Intergenic
No off target data available for this crispr