ID: 1194167328

View in Genome Browser
Species Human (GRCh38)
Location X:90534267-90534289
Sequence GCATTGAAACTGCTGGTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194167328_1194167334 13 Left 1194167328 X:90534267-90534289 CCAAGAACCAGCAGTTTCAATGC No data
Right 1194167334 X:90534303-90534325 AAGATAGCTATTCCAGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194167328 Original CRISPR GCATTGAAACTGCTGGTTCT TGG (reversed) Intergenic
No off target data available for this crispr