ID: 1194170531

View in Genome Browser
Species Human (GRCh38)
Location X:90575214-90575236
Sequence TGGAGTTCATCCGAGCTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194170520_1194170531 24 Left 1194170520 X:90575167-90575189 CCGATTAGTGTCTGTCCCAGCAA No data
Right 1194170531 X:90575214-90575236 TGGAGTTCATCCGAGCTGGTAGG No data
1194170522_1194170531 8 Left 1194170522 X:90575183-90575205 CCAGCAATGTGCCAGCAGAAAGG No data
Right 1194170531 X:90575214-90575236 TGGAGTTCATCCGAGCTGGTAGG No data
1194170521_1194170531 9 Left 1194170521 X:90575182-90575204 CCCAGCAATGTGCCAGCAGAAAG No data
Right 1194170531 X:90575214-90575236 TGGAGTTCATCCGAGCTGGTAGG No data
1194170528_1194170531 -3 Left 1194170528 X:90575194-90575216 CCAGCAGAAAGGGGAAGGGTTGG No data
Right 1194170531 X:90575214-90575236 TGGAGTTCATCCGAGCTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194170531 Original CRISPR TGGAGTTCATCCGAGCTGGT AGG Intergenic
No off target data available for this crispr