ID: 1194179188

View in Genome Browser
Species Human (GRCh38)
Location X:90692166-90692188
Sequence CTGTAGGAATGGTTTGTAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194179188_1194179196 -5 Left 1194179188 X:90692166-90692188 CCAATTACAAACCATTCCTACAG No data
Right 1194179196 X:90692184-90692206 TACAGCACAGGGGGAGGTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194179188 Original CRISPR CTGTAGGAATGGTTTGTAAT TGG (reversed) Intergenic
No off target data available for this crispr