ID: 1194187871

View in Genome Browser
Species Human (GRCh38)
Location X:90795460-90795482
Sequence ATGGAGTTCTTCAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194187871_1194187877 16 Left 1194187871 X:90795460-90795482 CCCTCTTCCTTGAAGAACTCCAT No data
Right 1194187877 X:90795499-90795521 CATTTAAGAAAGTTAAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194187871 Original CRISPR ATGGAGTTCTTCAAGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr