ID: 1194188758

View in Genome Browser
Species Human (GRCh38)
Location X:90808352-90808374
Sequence TATGTAGAACCTCCCAAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194188758_1194188763 21 Left 1194188758 X:90808352-90808374 CCCCATTTGGGAGGTTCTACATA No data
Right 1194188763 X:90808396-90808418 GAAAGATTAAGTAAACAGACTGG No data
1194188758_1194188762 -1 Left 1194188758 X:90808352-90808374 CCCCATTTGGGAGGTTCTACATA No data
Right 1194188762 X:90808374-90808396 AATGAGGAAAAATGAGATCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194188758 Original CRISPR TATGTAGAACCTCCCAAATG GGG (reversed) Intergenic
No off target data available for this crispr