ID: 1194188794

View in Genome Browser
Species Human (GRCh38)
Location X:90808676-90808698
Sequence TCTGACACACGGAACTACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194188794_1194188798 -2 Left 1194188794 X:90808676-90808698 CCCACGTAGTTCCGTGTGTCAGA No data
Right 1194188798 X:90808697-90808719 GACTGACAGCCTTCATGGAGTGG No data
1194188794_1194188797 -7 Left 1194188794 X:90808676-90808698 CCCACGTAGTTCCGTGTGTCAGA No data
Right 1194188797 X:90808692-90808714 TGTCAGACTGACAGCCTTCATGG No data
1194188794_1194188801 9 Left 1194188794 X:90808676-90808698 CCCACGTAGTTCCGTGTGTCAGA No data
Right 1194188801 X:90808708-90808730 TTCATGGAGTGGATTCATGAGGG No data
1194188794_1194188800 8 Left 1194188794 X:90808676-90808698 CCCACGTAGTTCCGTGTGTCAGA No data
Right 1194188800 X:90808707-90808729 CTTCATGGAGTGGATTCATGAGG No data
1194188794_1194188802 10 Left 1194188794 X:90808676-90808698 CCCACGTAGTTCCGTGTGTCAGA No data
Right 1194188802 X:90808709-90808731 TCATGGAGTGGATTCATGAGGGG No data
1194188794_1194188804 27 Left 1194188794 X:90808676-90808698 CCCACGTAGTTCCGTGTGTCAGA No data
Right 1194188804 X:90808726-90808748 GAGGGGATCTCCTATTTCAAGGG No data
1194188794_1194188803 26 Left 1194188794 X:90808676-90808698 CCCACGTAGTTCCGTGTGTCAGA No data
Right 1194188803 X:90808725-90808747 TGAGGGGATCTCCTATTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194188794 Original CRISPR TCTGACACACGGAACTACGT GGG (reversed) Intergenic
No off target data available for this crispr