ID: 1194193022

View in Genome Browser
Species Human (GRCh38)
Location X:90860230-90860252
Sequence ACACTCTGTTTCACAGAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194193020_1194193022 -5 Left 1194193020 X:90860212-90860234 CCCAGAAGCTTGGATCATACACT No data
Right 1194193022 X:90860230-90860252 ACACTCTGTTTCACAGAGATAGG No data
1194193021_1194193022 -6 Left 1194193021 X:90860213-90860235 CCAGAAGCTTGGATCATACACTC No data
Right 1194193022 X:90860230-90860252 ACACTCTGTTTCACAGAGATAGG No data
1194193016_1194193022 22 Left 1194193016 X:90860185-90860207 CCAGGTGATGGATTGGGCTGCGG No data
Right 1194193022 X:90860230-90860252 ACACTCTGTTTCACAGAGATAGG No data
1194193019_1194193022 -4 Left 1194193019 X:90860211-90860233 CCCCAGAAGCTTGGATCATACAC No data
Right 1194193022 X:90860230-90860252 ACACTCTGTTTCACAGAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194193022 Original CRISPR ACACTCTGTTTCACAGAGAT AGG Intergenic