ID: 1194193403

View in Genome Browser
Species Human (GRCh38)
Location X:90864722-90864744
Sequence AACTGGCAACAGAGGTATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194193399_1194193403 5 Left 1194193399 X:90864694-90864716 CCACCTAGAACAAAGTGTGCAAA No data
Right 1194193403 X:90864722-90864744 AACTGGCAACAGAGGTATCCAGG No data
1194193400_1194193403 2 Left 1194193400 X:90864697-90864719 CCTAGAACAAAGTGTGCAAATTC No data
Right 1194193403 X:90864722-90864744 AACTGGCAACAGAGGTATCCAGG No data
1194193398_1194193403 6 Left 1194193398 X:90864693-90864715 CCCACCTAGAACAAAGTGTGCAA No data
Right 1194193403 X:90864722-90864744 AACTGGCAACAGAGGTATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194193403 Original CRISPR AACTGGCAACAGAGGTATCC AGG Intergenic
No off target data available for this crispr