ID: 1194196733

View in Genome Browser
Species Human (GRCh38)
Location X:90903554-90903576
Sequence AGAGAGAGCACAGTGACTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194196733_1194196737 11 Left 1194196733 X:90903554-90903576 CCGCCAGTCACTGTGCTCTCTCT No data
Right 1194196737 X:90903588-90903610 CCTGATTTATCTATGCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194196733 Original CRISPR AGAGAGAGCACAGTGACTGG CGG (reversed) Intergenic
No off target data available for this crispr