ID: 1194199037

View in Genome Browser
Species Human (GRCh38)
Location X:90932770-90932792
Sequence CTTTTCTCGGCAGCCTCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194199033_1194199037 28 Left 1194199033 X:90932719-90932741 CCGCAGAGGCTGAACTAATTTAC No data
Right 1194199037 X:90932770-90932792 CTTTTCTCGGCAGCCTCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194199037 Original CRISPR CTTTTCTCGGCAGCCTCGCC AGG Intergenic