ID: 1194202342

View in Genome Browser
Species Human (GRCh38)
Location X:90968764-90968786
Sequence GACAGATGCTAGCAGTATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194202340_1194202342 -9 Left 1194202340 X:90968750-90968772 CCTTGCTCTTAGAAGACAGATGC No data
Right 1194202342 X:90968764-90968786 GACAGATGCTAGCAGTATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194202342 Original CRISPR GACAGATGCTAGCAGTATTA GGG Intergenic
No off target data available for this crispr