ID: 1194205803

View in Genome Browser
Species Human (GRCh38)
Location X:91009688-91009710
Sequence ATGACTACAGAGATCTAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194205803_1194205807 30 Left 1194205803 X:91009688-91009710 CCATGTTAGATCTCTGTAGTCAT No data
Right 1194205807 X:91009741-91009763 TGTATGCCCATGGATCCTCCAGG No data
1194205803_1194205806 20 Left 1194205803 X:91009688-91009710 CCATGTTAGATCTCTGTAGTCAT No data
Right 1194205806 X:91009731-91009753 GTGTTTGAGTTGTATGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194205803 Original CRISPR ATGACTACAGAGATCTAACA TGG (reversed) Intergenic
No off target data available for this crispr