ID: 1194208709

View in Genome Browser
Species Human (GRCh38)
Location X:91042318-91042340
Sequence TTTGATGTAGGGATTGAGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194208709_1194208712 23 Left 1194208709 X:91042318-91042340 CCGCACTCAATCCCTACATCAAA No data
Right 1194208712 X:91042364-91042386 CAACCTAACGTTGCGCCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194208709 Original CRISPR TTTGATGTAGGGATTGAGTG CGG (reversed) Intergenic