ID: 1194209400

View in Genome Browser
Species Human (GRCh38)
Location X:91052282-91052304
Sequence TGGTATTGTACCCATGACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194209400_1194209403 10 Left 1194209400 X:91052282-91052304 CCCACGTCATGGGTACAATACCA No data
Right 1194209403 X:91052315-91052337 GAATTTCTTGCACAAAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194209400 Original CRISPR TGGTATTGTACCCATGACGT GGG (reversed) Intergenic
No off target data available for this crispr