ID: 1194215284

View in Genome Browser
Species Human (GRCh38)
Location X:91123692-91123714
Sequence TCACCCTGAGGGGTGGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194215277_1194215284 -2 Left 1194215277 X:91123671-91123693 CCCCACAGCTGATCTCTCAGCTC No data
Right 1194215284 X:91123692-91123714 TCACCCTGAGGGGTGGCTCATGG No data
1194215278_1194215284 -3 Left 1194215278 X:91123672-91123694 CCCACAGCTGATCTCTCAGCTCA No data
Right 1194215284 X:91123692-91123714 TCACCCTGAGGGGTGGCTCATGG No data
1194215279_1194215284 -4 Left 1194215279 X:91123673-91123695 CCACAGCTGATCTCTCAGCTCAC No data
Right 1194215284 X:91123692-91123714 TCACCCTGAGGGGTGGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194215284 Original CRISPR TCACCCTGAGGGGTGGCTCA TGG Intergenic