ID: 1194215348

View in Genome Browser
Species Human (GRCh38)
Location X:91124175-91124197
Sequence ACTTGGCCCTGGGGTGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194215348_1194215355 0 Left 1194215348 X:91124175-91124197 CCTGTTACACCCCAGGGCCAAGT No data
Right 1194215355 X:91124198-91124220 TTTCCAGTGGGTCATGACACAGG No data
1194215348_1194215357 26 Left 1194215348 X:91124175-91124197 CCTGTTACACCCCAGGGCCAAGT No data
Right 1194215357 X:91124224-91124246 AATCCTGCCCCTGTACCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194215348 Original CRISPR ACTTGGCCCTGGGGTGTAAC AGG (reversed) Intergenic
No off target data available for this crispr