ID: 1194217217

View in Genome Browser
Species Human (GRCh38)
Location X:91145710-91145732
Sequence CAGAATATCCAGAAACAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194217217_1194217218 25 Left 1194217217 X:91145710-91145732 CCGGGCTGTTTCTGGATATTCTG No data
Right 1194217218 X:91145758-91145780 AACTCATTATTGACCTGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194217217 Original CRISPR CAGAATATCCAGAAACAGCC CGG (reversed) Intergenic
No off target data available for this crispr