ID: 1194221442

View in Genome Browser
Species Human (GRCh38)
Location X:91197630-91197652
Sequence TCTTCTATTGCACCTCAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194221441_1194221442 21 Left 1194221441 X:91197586-91197608 CCATTTGTGTAATAGTAAAGATG No data
Right 1194221442 X:91197630-91197652 TCTTCTATTGCACCTCAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194221442 Original CRISPR TCTTCTATTGCACCTCAAAC TGG Intergenic
No off target data available for this crispr