ID: 1194234175

View in Genome Browser
Species Human (GRCh38)
Location X:91361663-91361685
Sequence GAATATGAATGAGGGGCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194234169_1194234175 4 Left 1194234169 X:91361636-91361658 CCTCAATTCTTGCCTCCTCAGAA 0: 246
1: 366
2: 273
3: 159
4: 473
Right 1194234175 X:91361663-91361685 GAATATGAATGAGGGGCATAAGG No data
1194234170_1194234175 -8 Left 1194234170 X:91361648-91361670 CCTCCTCAGAAGAAAGAATATGA No data
Right 1194234175 X:91361663-91361685 GAATATGAATGAGGGGCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194234175 Original CRISPR GAATATGAATGAGGGGCATA AGG Intergenic
No off target data available for this crispr