ID: 1194239297

View in Genome Browser
Species Human (GRCh38)
Location X:91423895-91423917
Sequence GGCTTTAATCAAATGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194239292_1194239297 8 Left 1194239292 X:91423864-91423886 CCTACTGTGGATGAGGGATGGAC No data
Right 1194239297 X:91423895-91423917 GGCTTTAATCAAATGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194239297 Original CRISPR GGCTTTAATCAAATGGAGCC TGG Intergenic
No off target data available for this crispr