ID: 1194240381

View in Genome Browser
Species Human (GRCh38)
Location X:91437717-91437739
Sequence CACCTGTGAATATTATCAAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 223}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194240381_1194240384 -3 Left 1194240381 X:91437717-91437739 CCTTTTGATAATATTCACAGGTG 0: 1
1: 0
2: 1
3: 17
4: 223
Right 1194240384 X:91437737-91437759 GTGTTTCAAAGGTAAGGAATAGG 0: 1
1: 0
2: 1
3: 20
4: 226
1194240381_1194240383 -9 Left 1194240381 X:91437717-91437739 CCTTTTGATAATATTCACAGGTG 0: 1
1: 0
2: 1
3: 17
4: 223
Right 1194240383 X:91437731-91437753 TCACAGGTGTTTCAAAGGTAAGG 0: 1
1: 0
2: 2
3: 15
4: 153
1194240381_1194240385 8 Left 1194240381 X:91437717-91437739 CCTTTTGATAATATTCACAGGTG 0: 1
1: 0
2: 1
3: 17
4: 223
Right 1194240385 X:91437748-91437770 GTAAGGAATAGGTTGTCTCTTGG 0: 1
1: 0
2: 1
3: 8
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194240381 Original CRISPR CACCTGTGAATATTATCAAA AGG (reversed) Exonic
901174919 1:7291931-7291953 CAGCTGAGAATACTATCCAAGGG + Intronic
901486826 1:9569267-9569289 CACCTGGGGATGTTATGAAAAGG + Intronic
901949955 1:12736001-12736023 CACCTGTGAACATTAGAAATTGG - Intergenic
903242402 1:21992135-21992157 GAGCTGTAAATATTAACAAAGGG + Intronic
903245914 1:22015320-22015342 GAGCTGTAAATATTAACAAAGGG + Intergenic
906068717 1:43001897-43001919 CACCTCTTAATATTATCACCTGG + Intergenic
910778208 1:90897627-90897649 CACCTGTGCTTTCTATCAAAGGG - Intergenic
912569383 1:110610311-110610333 CACCTGAGAAGATTCACAAATGG - Intronic
913351434 1:117865086-117865108 CAGCTGAGGATATTATTAAATGG - Exonic
918774046 1:188606172-188606194 TACCTATGAATATCATCAAAAGG - Intergenic
921874037 1:220174163-220174185 CACATGTGAACATTTTTAAAGGG - Intronic
924246267 1:242088065-242088087 AGCCTGTGAATCTTATCCAATGG - Exonic
924402378 1:243699694-243699716 AACCTGTGAATATTACCTTATGG + Intronic
924442439 1:244097414-244097436 GATCTGTGAAAATTATCAAAAGG + Intergenic
924753754 1:246922680-246922702 CACCTATCAATAGTATCAATAGG + Intronic
1063019294 10:2111058-2111080 AAGGTGTGCATATTATCAAAGGG + Intergenic
1063669752 10:8090579-8090601 CACCTGTCAATGCTATAAAAAGG + Intergenic
1064344502 10:14519238-14519260 CCCCTGTGAATACGATCAAGTGG + Exonic
1064371342 10:14754238-14754260 CACCAGTGAAAATTCTTAAAGGG + Intronic
1065614979 10:27511867-27511889 CAACTGTGATGGTTATCAAATGG + Intronic
1066744412 10:38592034-38592056 CATCATTGAATGTTATCAAAAGG + Intergenic
1068409451 10:56636103-56636125 CACCTCTTAATACTATCACATGG - Intergenic
1069143442 10:64858494-64858516 AACATGTTAATATTATAAAAAGG - Intergenic
1070392395 10:75982719-75982741 CACCTGAGATTATTATTACATGG + Intronic
1071854991 10:89615035-89615057 CTCCTGTAAATATTAACAACTGG - Intronic
1072356078 10:94612450-94612472 CACTTGTGAATATGAGGAAAAGG - Intronic
1073243721 10:102074807-102074829 CCCCTGTGAATATTGGGAAAGGG + Intergenic
1074928155 10:118094597-118094619 CAGCCATGAATATCATCAAAAGG + Intergenic
1075304049 10:121351939-121351961 CACCTGAGAACATTATCAGAGGG - Intergenic
1077356088 11:2118778-2118800 CACTTCTCAATATTATCATATGG + Intergenic
1080695272 11:34598150-34598172 CACCTGGGAAGATTGTGAAAAGG - Intergenic
1081471700 11:43379061-43379083 CACATGTAAATGTTAGCAAAGGG - Intronic
1086049564 11:82573874-82573896 CAACTGTCATTATTAACAAATGG + Intergenic
1086587981 11:88478117-88478139 CACCTCTGAATATTATTTACTGG + Intergenic
1088229089 11:107655156-107655178 CATCTGTGTATATAATAAAATGG + Intronic
1088721401 11:112595246-112595268 CACTCATGAAGATTATCAAATGG - Intergenic
1090410199 11:126502895-126502917 CACCTGTAAATCTTATTAAATGG - Intronic
1090536747 11:127650811-127650833 CACCAGTCAATATCATGAAAAGG + Intergenic
1090768646 11:129898748-129898770 CAACTGTGATTAATATGAAAAGG - Intergenic
1094416197 12:30217744-30217766 CAACTGTGGATATGATCATAAGG + Intergenic
1095584402 12:43835056-43835078 CACTAGTGTATATAATCAAATGG - Intergenic
1097494056 12:60307867-60307889 AAGTTGTGAATATTATCACATGG - Intergenic
1099636610 12:85221793-85221815 AAACTTTGAATATTATCTAAAGG + Intronic
1100459111 12:94780898-94780920 TACCTGTTAATATTCTGAAAAGG - Intergenic
1101227431 12:102703583-102703605 CACCTGTAAATAGCATCAATTGG + Intergenic
1102842069 12:116135542-116135564 AACCTGTGAACATAATGAAATGG + Intronic
1108150266 13:47526311-47526333 CAGATGTGAATATTGTCACAAGG - Intergenic
1109925724 13:69136101-69136123 CACCTTTGAATATAGACAAAAGG - Intergenic
1109978958 13:69880651-69880673 CACCTGTGCATGTCATTAAATGG - Intronic
1110689342 13:78413638-78413660 GACCTTAGAATATTTTCAAATGG + Intergenic
1110729894 13:78867725-78867747 CACATGTGAATATTAACCCATGG - Intergenic
1111974179 13:94948196-94948218 AGCCTGTGAATAGTATTAAATGG - Intergenic
1112666684 13:101583289-101583311 CACCTGTGAATGTGATGAGAGGG + Exonic
1115372968 14:32639645-32639667 CACCTGTGAAAAATACCACAAGG + Intronic
1115499286 14:34035138-34035160 CACGTGTGAATATTAACAATTGG - Intronic
1116988864 14:51251817-51251839 CACCTGGGAATTTTAAGAAATGG - Intronic
1117649157 14:57884128-57884150 AATCTGTCAATATTATCAAAAGG - Intronic
1118957257 14:70494091-70494113 CATCTGTGAAGATTATTCAAAGG + Intergenic
1120600065 14:86492621-86492643 TCCCTGTGAATTTTCTCAAATGG - Intergenic
1121082954 14:91123395-91123417 CACTTGTGAATATTTAGAAACGG + Intronic
1121507999 14:94491016-94491038 CAGCTTTGAATATCATCAACAGG + Intronic
1121625755 14:95384470-95384492 CACCTGAGACTATCATCATATGG + Intergenic
1123670727 15:22654296-22654318 CACCTGCAAATATCATCATATGG - Intergenic
1124526701 15:30460721-30460743 CACCTGCAAATATCATCATATGG - Intergenic
1124771952 15:32546962-32546984 CACCTGCAAATATCATCATATGG + Intergenic
1125126608 15:36230758-36230780 CACATGTGAAGGTTATGAAATGG + Intergenic
1125144994 15:36456629-36456651 CAGCTGTGATTATTATATAATGG - Intergenic
1126481738 15:49131329-49131351 CAACTGTGAAAATTTTCAAAAGG + Intronic
1126523116 15:49619589-49619611 CACCTGTGAACATAATAAAATGG + Intronic
1128122457 15:65162825-65162847 CAAATGTGAATATTAGCAACTGG - Intronic
1129293396 15:74585521-74585543 CAGTTGTGATTATTACCAAAGGG - Intronic
1134564674 16:15240950-15240972 CACCTGTGGCCATTTTCAAATGG + Intergenic
1134737824 16:16515749-16515771 CACCTGTGGCCATTTTCAAATGG - Intergenic
1134929679 16:18196409-18196431 CACCTGTGGCCATTTTCAAATGG + Intergenic
1135238628 16:20782696-20782718 CACCTGCGCATATGACCAAATGG + Intronic
1136941423 16:34587674-34587696 CACCTTTGAATGGAATCAAAGGG + Intergenic
1136942017 16:34595233-34595255 CACCTTTGAATGGAATCAAAGGG - Intergenic
1136953840 16:34756429-34756451 CATCATTGAATATAATCAAATGG - Intergenic
1136966803 16:34921391-34921413 CACCAATGAATAGAATCAAATGG - Intergenic
1137086067 16:36125303-36125325 CATCTTTGAATAAAATCAAATGG + Intergenic
1137215875 16:46389844-46389866 CACCTTTGAATGGAATCAAAGGG + Intergenic
1137829202 16:51527413-51527435 CAACTCTGAATTTTTTCAAAAGG + Intergenic
1138647382 16:58435024-58435046 CACCTCTTAATACTATCACATGG + Intergenic
1141117487 16:81322751-81322773 CACCTCTGAATAATAGTAAATGG + Intronic
1141216185 16:82026202-82026224 CATCTTTGATTATTTTCAAATGG + Intergenic
1141360245 16:83388875-83388897 CACCTGTGGATCTTATTAAACGG - Intronic
1141416083 16:83876099-83876121 CACTTGTTAAAAATATCAAAAGG + Intergenic
1142038165 16:87875374-87875396 CACCTGTGAAGATAAGCTAACGG + Intergenic
1146566969 17:33921856-33921878 GAGGAGTGAATATTATCAAATGG + Intronic
1149743230 17:59068613-59068635 CAGCACTGAATATTATTAAAAGG - Intronic
1151057014 17:71044005-71044027 GAAGTGTGAATATTATTAAATGG - Intergenic
1151109802 17:71662810-71662832 CATCTGTAAATAGTATCATATGG - Intergenic
1152346052 17:79752538-79752560 AACCTGTGTATTTTATTAAAAGG - Intergenic
1203187086 17_KI270729v1_random:134771-134793 CATCATTGAATGTTATCAAATGG - Intergenic
1153064145 18:1025913-1025935 CACCCATGACTATTATGAAAAGG - Intergenic
1157280164 18:46341717-46341739 CACATGTGAATAACATCACAAGG - Intronic
1157740514 18:50088943-50088965 GACTTGTGAATATCATCTAAGGG + Intronic
1157944203 18:51960237-51960259 CTCCTGTAAATAATTTCAAAAGG - Intergenic
1158486593 18:57872006-57872028 CAACTGTGAAAATTAACTAAAGG + Intergenic
1159317409 18:66795084-66795106 TGCCTGCGAACATTATCAAATGG + Intergenic
1160358926 18:78253548-78253570 TTCCTGTGGATTTTATCAAAAGG - Intergenic
1164322820 19:24166046-24166068 TACCTATGAAAATTATTAAATGG - Intergenic
1164928088 19:32146477-32146499 GACCTGTGGATAATAACAAAAGG + Intergenic
925592505 2:5524583-5524605 AACTTGTTAATCTTATCAAAAGG - Intergenic
926851936 2:17208155-17208177 CACCTCTGTATATTATTAGAAGG + Intergenic
927547106 2:23963801-23963823 CACCTCTGGATATTATCCAAAGG + Intronic
929172406 2:38945170-38945192 CACCAGTGTATATTACCCAATGG - Intronic
930502407 2:52238126-52238148 CACCTGTGAATTTTGTCATCGGG - Intergenic
931269612 2:60689840-60689862 CACCTCTTAATACTATCAATTGG - Intergenic
932958988 2:76390016-76390038 CATCTGTGAGTATAATCAAGTGG - Intergenic
933891338 2:86773576-86773598 TCCCGGTGAATATTATCATAGGG + Exonic
934332593 2:92084508-92084530 CATCTTTGAATGTAATCAAAAGG - Intergenic
937182130 2:120006243-120006265 CACCTGGGGATCTTATTAAAAGG - Intergenic
939652561 2:144782848-144782870 TACCTGTGAACATTTTCTAAAGG - Intergenic
939794622 2:146627027-146627049 CACCACTGAATATTCTCAGAGGG + Intergenic
941191447 2:162388712-162388734 CTCCTGTGAAAATTATTGAAGGG - Intronic
943588438 2:189767386-189767408 CCCCTGTAAAAATTATAAAATGG + Intergenic
943881580 2:193152036-193152058 AACATGTGAATATTATCATCAGG + Intergenic
944143906 2:196485589-196485611 CACCTCTTAACATTATCACATGG + Intronic
945059522 2:205896599-205896621 CACTTGTGAATATTTAGAAATGG - Intergenic
945659082 2:212662095-212662117 CACCTGTGAATATTTACAAAGGG - Intergenic
946286461 2:218707328-218707350 TCCCTGAGAATATTATCAACAGG - Intergenic
1169873397 20:10270958-10270980 CACCAGTGCTTATTAGCAAAGGG - Intronic
1170194973 20:13680419-13680441 CCCTTGGGAATATTATAAAAGGG + Intergenic
1173877118 20:46380348-46380370 CACCTGTGACTACTATCGAGAGG + Intronic
1174856721 20:54052519-54052541 CACCTCTTAATATGATCACATGG - Intronic
1176320006 21:5305289-5305311 CACTTGTGGATATTACCAAAAGG - Intergenic
1176477436 21:7236327-7236349 CACTTGTGGATATTACCAAAAGG - Intergenic
1178272690 21:31207093-31207115 CACATGTGAATAATATCAGTAGG + Intronic
1180527612 22:16310572-16310594 CACCAGTGAATGGTATCTAAGGG - Intergenic
1180533579 22:16373282-16373304 CATCTTTGAATAGAATCAAATGG + Intergenic
1182013729 22:27021862-27021884 CACCTGGGAATGTTGTTAAAAGG + Intergenic
1203316064 22_KI270737v1_random:12514-12536 CATCTTTGAATAGAATCAAATGG - Intergenic
1203322192 22_KI270737v1_random:76613-76635 CACCAGTGAATGGTATCTAAGGG + Intergenic
1202726779 2_KI270716v1_random:8127-8149 CACCATTGAATAGAATCAAATGG - Intergenic
1202727012 2_KI270716v1_random:11116-11138 CATCTTTGAATGTAATCAAAAGG - Intergenic
952257241 3:31706130-31706152 CAACTGTGCCTATTAGCAAATGG + Intronic
952849577 3:37716384-37716406 CACCTGAAAAAATTTTCAAAGGG + Intronic
954088742 3:48268085-48268107 CCCCTGTGATTTTTATCAGAAGG - Exonic
956540402 3:70331784-70331806 CTTCTGTGAATAGAATCAAATGG - Intergenic
957013296 3:75032767-75032789 CACCTGTGAATAACAACACAAGG - Intergenic
958472754 3:94542131-94542153 AACCTATAAATATTATCTAAAGG + Intergenic
958735055 3:97999520-97999542 CACTTTTGACTCTTATCAAATGG - Intronic
960173057 3:114485631-114485653 CACCTCTTAATACTATCACATGG - Intronic
961626881 3:128270214-128270236 TACATGAGAATAATATCAAATGG - Intronic
962921612 3:139955462-139955484 GACCTGTGAGCATAATCAAATGG - Intronic
963179727 3:142341431-142341453 CACTTGTCAATAATAACAAAAGG + Intronic
964136996 3:153355211-153355233 CAACTGTGATTAATAACAAAAGG - Intergenic
964151110 3:153525435-153525457 CACCTCTGTGTATTTTCAAATGG + Intergenic
964323794 3:155525285-155525307 CACCTCTTAATACTATCATATGG - Intronic
964401699 3:156306449-156306471 CACATGTTAATATCTTCAAATGG - Intronic
965369829 3:167848081-167848103 CACTTGTGAATGTGATCATATGG + Intergenic
966196434 3:177318653-177318675 CACCTGTTAAGGTGATCAAATGG + Intergenic
966257587 3:177935107-177935129 TAGGTGTCAATATTATCAAAGGG - Intergenic
966578876 3:181536737-181536759 AACTTGTGAATATCAACAAAAGG - Intergenic
967038146 3:185663489-185663511 CACTTGTGAAAATTAAAAAATGG + Intronic
970098607 4:12493912-12493934 CAACCGTGAGTATTAACAAATGG - Intergenic
970637680 4:18026488-18026510 GACTTGTGAATATTATCTACTGG - Intergenic
972200456 4:36708329-36708351 CTCTTGTTAATATTATCAAATGG - Intergenic
973554670 4:52070921-52070943 CACATGCGAAGATAATCAAAAGG - Intronic
976109105 4:81651846-81651868 TATCTCTGAATATTCTCAAAAGG + Intronic
978561015 4:110033269-110033291 TAACTGATAATATTATCAAAAGG + Intergenic
979087474 4:116430821-116430843 AACCTGTGAAGATTATGAACAGG - Intergenic
979382497 4:120024220-120024242 GACCTGTGAACAATATCAACAGG + Intergenic
980066362 4:128193541-128193563 CAGCTATGGGTATTATCAAATGG - Intronic
980845878 4:138324576-138324598 CACCTGTGAATGATATGTAAAGG - Intergenic
981343683 4:143651028-143651050 AACATATGAATATTATTAAAAGG - Intronic
981568568 4:146127494-146127516 CATCTGTGAAGATAATCATATGG + Intergenic
986472812 5:8092975-8092997 TACCTGTGAACATTTTCAACTGG - Intergenic
988609035 5:32708561-32708583 CCCCTGAGAATATTTTTAAATGG - Intronic
990075234 5:51837425-51837447 TATCTGTGAATCTTATCCAATGG + Intergenic
990229107 5:53691279-53691301 CATCTGTGGATATGATCATATGG - Intergenic
991500804 5:67274822-67274844 AACCTGTGAATATTACCTTATGG - Intergenic
992010074 5:72517107-72517129 CACCTGTGAATATTCCCACCTGG - Intergenic
994709889 5:103254603-103254625 GCCCTTTGAAGATTATCAAATGG + Intergenic
997343046 5:133161583-133161605 AACCTGTGGATATTACCTAAAGG + Intergenic
999395310 5:151223398-151223420 CACCTGGGCATATTGTTAAAAGG + Intronic
999841833 5:155436158-155436180 CACCTGTCAATGTTCTAAAAGGG + Intergenic
1003693950 6:8383511-8383533 CATCAGTCAATATTATCAATGGG + Intergenic
1003826671 6:9960486-9960508 ACCCTCTGAATATTATCTAAAGG + Intronic
1006435375 6:34023301-34023323 AACCTTAAAATATTATCAAAGGG + Intronic
1007928373 6:45668421-45668443 CACCTCTTAATACTATCACATGG + Intergenic
1011614161 6:89182712-89182734 CAGCTGAGAATATTGTTAAATGG - Intronic
1012196438 6:96347352-96347374 CACCTGTTAAAATGAGCAAATGG - Intergenic
1012779426 6:103537948-103537970 GACATGTGAATATTCTTAAATGG - Intergenic
1015097700 6:129435829-129435851 CATCTGTGAAGAATAGCAAAGGG - Intronic
1015186575 6:130423570-130423592 CACATGGAAATATTAACAAAAGG - Intronic
1018290170 6:162284694-162284716 CAGCTGTGAATGTCTTCAAACGG - Intronic
1022061949 7:26805967-26805989 CAGATGTGAAAATTACCAAAAGG - Intronic
1022144101 7:27519988-27520010 CACCCTTGAGTATTCTCAAATGG - Intergenic
1022459364 7:30590099-30590121 CACTGGTGAATTCTATCAAATGG + Intergenic
1025475299 7:60912515-60912537 CATCAGTGAATACAATCAAATGG - Intergenic
1025484255 7:61026618-61026640 CATCTTTGAATAAAATCAAATGG - Intergenic
1025485324 7:61040217-61040239 CATCATTGAATGTTATCAAATGG + Intergenic
1025555447 7:62302017-62302039 CATCTTTGAATAAAATCAAATGG + Intergenic
1025563784 7:62404939-62404961 CATCAGTGAATGTAATCAAATGG + Intergenic
1027860422 7:83571471-83571493 CACCTGTGAAGATGATCATATGG - Intronic
1028303020 7:89226200-89226222 CACTTTTGATTATTATGAAAAGG + Intronic
1028664644 7:93327308-93327330 CACGTGTGACTACTATCATATGG + Intronic
1028893510 7:96014586-96014608 CAACTGTGGATCTAATCAAATGG + Intronic
1028899250 7:96077450-96077472 CATCTTTGAAAATAATCAAAAGG + Intronic
1030558513 7:111056517-111056539 CACCTGTAATTATTACGAAAGGG - Intronic
1032162437 7:129521094-129521116 CTCCTGTGTATATTTTTAAAGGG - Intergenic
1032892666 7:136215988-136216010 CATCTGTCAATATTGTCACATGG + Intergenic
1033041464 7:137922841-137922863 CTCCTTTGAAAATTCTCAAAGGG - Intronic
1035706954 8:1683204-1683226 CACCTGGGAAGATTCTCAGAAGG + Intronic
1037682555 8:21109644-21109666 CTCCTGTGAAGATTATAACAGGG + Intergenic
1043141548 8:76596063-76596085 GACCTGTGACTAAAATCAAATGG + Intergenic
1043213619 8:77556517-77556539 CATCTGTTAAAATTATCATATGG - Intergenic
1043217491 8:77611170-77611192 AAATTGTGAATATTTTCAAAAGG + Intergenic
1045840085 8:106569990-106570012 CAGCTGTGAAAATTATGTAAGGG - Intronic
1051952452 9:22652694-22652716 AACCTGTGAATATCTTTAAATGG - Intergenic
1052396701 9:27947832-27947854 CACTGGTGAATATTATCCTATGG + Intergenic
1053948700 9:43343752-43343774 CAACATTGAATATAATCAAATGG - Intergenic
1055388545 9:75792839-75792861 ACCATGTGAATATTAGCAAATGG + Intergenic
1057452168 9:95174371-95174393 CCCCTCTTAATATTATCACATGG + Intronic
1058154155 9:101493359-101493381 CACCTGTGGATAACATCCAAGGG - Intronic
1058223499 9:102331780-102331802 CATCTGTAAATTTTATCATAAGG + Intergenic
1203591880 Un_KI270747v1:71950-71972 CAACATTGAATATAATCAAATGG - Intergenic
1186152000 X:6685083-6685105 CACCAGTGAATTTTTTAAAAGGG + Intergenic
1187819923 X:23276530-23276552 CAGCTGTGAAAATTAGCAAACGG + Intergenic
1188631815 X:32372801-32372823 CATTTGTTAATATTCTCAAATGG + Intronic
1188758632 X:33997476-33997498 CACCTCTTAATACTACCAAATGG - Intergenic
1188809367 X:34633999-34634021 CATCTGTGAATTTTATTACATGG - Intronic
1188839984 X:35005232-35005254 CACCAGTGAAAATTATTAAAAGG + Intergenic
1188887753 X:35571273-35571295 GACTTGTTAATATTTTCAAATGG - Intergenic
1189679748 X:43503471-43503493 CAACTGTGAATATTTCCATAGGG - Intergenic
1190370306 X:49734018-49734040 CACCTGTTAATACCATCACATGG - Intergenic
1191686400 X:63896509-63896531 CAACAGTGAATAATCTCAAAAGG + Intergenic
1192630554 X:72774624-72774646 CTTCAGTGAATATCATCAAACGG + Intergenic
1192651156 X:72946180-72946202 CTTCAGTGAATATCATCAAACGG - Intergenic
1193589583 X:83371739-83371761 CACCTCTTAATACTATCATATGG + Intergenic
1193689902 X:84628734-84628756 TACCTTTGAATATTATAACATGG + Intergenic
1194240381 X:91437717-91437739 CACCTGTGAATATTATCAAAAGG - Exonic
1195502826 X:105622587-105622609 CTGCTGTGAATATTATTAAAAGG - Intronic
1198299198 X:135317822-135317844 CACCTGTACATATCATCAAGAGG - Intronic
1198993417 X:142544184-142544206 CACCTTTGAAAATTATGACAGGG - Intergenic
1199249440 X:145643045-145643067 CTCATGTGGATATGATCAAATGG + Intergenic
1199362023 X:146931921-146931943 AACCTGTGAATGTTATCTTATGG - Intergenic
1201428980 Y:13886575-13886597 CACCTTTGAATACTCTAAAAAGG - Intergenic
1201646603 Y:16240208-16240230 TACCTTTGAGTTTTATCAAATGG - Intergenic
1201656210 Y:16345109-16345131 TACCTTTGAGTTTTATCAAATGG + Intergenic