ID: 1194245583

View in Genome Browser
Species Human (GRCh38)
Location X:91507882-91507904
Sequence CAGGACTTTCCCTGGTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194245583_1194245589 25 Left 1194245583 X:91507882-91507904 CCTACAAACCAGGGAAAGTCCTG No data
Right 1194245589 X:91507930-91507952 CTACCAAACGTATAAAGACCTGG No data
1194245583_1194245590 26 Left 1194245583 X:91507882-91507904 CCTACAAACCAGGGAAAGTCCTG No data
Right 1194245590 X:91507931-91507953 TACCAAACGTATAAAGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194245583 Original CRISPR CAGGACTTTCCCTGGTTTGT AGG (reversed) Intergenic
No off target data available for this crispr