ID: 1194250187

View in Genome Browser
Species Human (GRCh38)
Location X:91564727-91564749
Sequence TCATAAGCACAGATGGCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194250187_1194250192 19 Left 1194250187 X:91564727-91564749 CCAAGTGCCATCTGTGCTTATGA No data
Right 1194250192 X:91564769-91564791 ACATTTCCATGATTATCATCGGG No data
1194250187_1194250191 18 Left 1194250187 X:91564727-91564749 CCAAGTGCCATCTGTGCTTATGA No data
Right 1194250191 X:91564768-91564790 GACATTTCCATGATTATCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194250187 Original CRISPR TCATAAGCACAGATGGCACT TGG (reversed) Intergenic
No off target data available for this crispr